Page 6 - Oligonucleotide Therapeutics Solution Guide
P. 6

Characteristic analysis
                  Purification
                                           Quality Control

                     Separation of Impurities                                                                                           Nexera XS inert




                                                                                                                                           Features
                                    Oligonucleotide Analysis by Ion
                                                                                                                                        The potential adsorption of an analyte onto wetted surfaces of        System Controller            Modification
                                   Exchange Chromatography (IEX)                                                                        UHPLC instruments poses some critical challenges when analyzing       SCL-40, CBM-40/40lite          Target selection
                                                                                                                                        biomolecules. While elevated pressure tolerance is required to
                                                                                                 click here                             achieve optimal chromatographic separation when using small           Used to coordinate actions of the overall
                                                                                                                                                                                                              system, this controller offers intuitive operation
                                                                                                                                        particle size columns, the inertness of the wetted surfaces is also   that minimizes the stress involved in operating
                                                                                                                                                                                                              the system, from startup to shutdown.
                                                                                                                                        of the utmost importance, as is resistance to corrosion due to the
                                        •   Short chain oligonucleotides can be separated based on the base unit.                       use of mobile phases with high salt concentrations and extreme        Detector
                                                                                                                                        pH values.                                                            SPD-40/40V/M40
                                        •   Oligonucleotides can be separated from impurities such as protecting                        The Nexera XS inert system offers the ideal solution for the          Inert type cells for UHPLC analysis eliminate
                                          groups used in the chemical synthesis process.                                                separation of biomolecules by combining the elevated pressure         the risk of adsorption on the detector.
                                                                                                                                                                                                              Low-diffusion cell, which has 5 mm of
                           benefits                                                                                                     tolerance of a UHPLC system with complete inertness of the            optical path length, can also be selected.
                                        •   It can be analyzed using mobile phases with high salt concentrations                        sample flow path, ensured by the absence of wetted metal                                             Excision
                                          and a wide pH range.                                                                          surfaces and offering ultra-high resistance to corrosion.             Solvent Delivery Unit        Unprotected
                                                                                                                                                                                                              LC-40D XSi                       Oligomer synthesis
                                                                                                                                                                                                              Designed with corrosion-resistant non-stainless
                                                                                                                                                                                                              steel materials, it offers rugged, low-pulsation
                        Methods and Results                                                                                                                                                                   performance, advanced AI features and solvent
                                                                                                                                                                                                              blending capabilities. (optional).
                     Sample   5‘-TCTTGGTTACATGAAA-3‘   (16 mer)
                              5‘-TCTTGGTTACATGAAAT-3‘   (17 mer)                                                                                                                                              Autosampler
                              5‘-TCTTGGTTACATGAAATC-3‘   (18 mer)                                                                                                                                             SIL-40C XSi
                              5‘-TCTTGGTTACATGAAATCC-3‘   (19 mer)                                                                       Unconstrained Recovery and Sensitivity                               This high-performance autosampler
                              5‘-TCTTGGTTACATGAAATCCC-3‘  (20 mer)
                                                                                                                                         Reduces sample loss due to adsorption to metal and achieves excellent sensitivity.  features nonmetal materials for all surfaces
                     Conc., Volume 5 µmol/L, 4 µL                                                                                                                                                             that contact liquids. That inhibits metal-ad-
                     Preparation  Dilution in ultrapure water to the concentrations above.                                               Clear Resolution without Restrictions                                sorption of biomolecules.
                     Analytical   As shown in Table 1                                                                                    Improves peak shape and achieves excellent chromatographic separation.                            Purification
                     Conditions                                                                                                                                                                               UHPLC Inert Switching Valve
                                                                             Figure 1   Chromatogram of oligonucleotides mixture                                                                              FCV-0206H2i/FCV-0607H2i
                     Results  Target oligonucleotides in 20 mer and 4 sequences that were                                                Assured Reliability and Reproducibility
                              deleted from n-1 to n-4 on the 3’ terminus of target were                                                                                                                       Designed with adsorption-inhibiting
                              prepared as impurities derived from the synthesis. All of them   Table 2   Relative standard deviation (% RSD) of each component (n = 6)  Reliable data for metal-adsorbing compounds with high reproducibility.  materials for all wetted surfaces.
                              were unmodified single-stranded DNA and synthesized by
                              a solid phase synthesis (HPLC-purified). For ion-exchange   Length(mer)  Retention time  Area
                              chromatography, Figure 1 shows a chromatogram of a mixture   16  0.138  0.224
                              of five-sequence oligonucleotide. Each oligonucleotide was   17  0.105  0.335
                              separated by their length. Table 2 shows the relative standard                                            Finger Tight Fittings for Simple and Secure Connections
                              deviations (% RSD, n = 6) of the retention time and area of the   18  0.098  0.494
                              16 - 20 mer oligonucleotide mixture, with RSD% less than 1%   19  0.085  0.161                            Nexera XS inert systems feature tubing connections with unique finger-tight
                              for both parameters.                          20         0.075      0.307                                 fittings. They can achieve connections with up to 105 MPa of pressure capacity by
                              And then, a mixture of five oligonucleotides was prepared (four
                              of them were HPLC-purified while 1 was only desalted) and                                                 finger-tightening and without creating any dead volume.
                              compared with the mixture of all HPLC-purified nucleotides
                              (Figure 2). The target oligonucleotides were completely separated   1 : 5’- TCTTGGTTACATGAAA -3’
                              from impurities such as free protecting groups and shorter length   2 : 5’- TCTTGGTTACATGAAAT -3’  3 4                                                                                                       Quality Control
                              oligonucleotides.                         3 : 5’- TCTTGGTTACATGAAATC- 3’                                                                                                                                        Characteristic analysis
                                                                        4 : 5’- TCTTGGTTACATGAAATCC -3’  2  5
                                                                        5 : 5’- TCTTGGTTACATGAAATCCC -3’  1
                                    Table 1   Analysis Conditions                                                                       Resolution without Restrictions
                     System:          Nexera XS inert
                     Column:          Shim-pack Bio IEX Q-NP                                                                            The Nexera XS inert system is equipped with unique technology that ensures the complete inertness of the sample flow path. The system provides
                                      (100 mm × 4.6 mm I.D., 5 µm)                                                                      excellent peak shape and unsurpassed chromatographic separation by effectively inhibiting the adsorption of target compounds to internal surfaces.
                     Mobile phase A:  10 mmol/L NaOH
                     Mobile phase B:  10 mmol/L NaOH containing 1 mol/L NaClO4
                                                                                       Shorter length of                                               Standard UHPLC (stainless steel-based)            Nexera XS inert
                     Flow rate:       0.8 mL/min                       Protecting groups  oligonucleotides                                     mAU                                        mAU                                              DDS
                     Time program:    25-32.5% (0-15 min) → 100% (15-20 min) →                                                                                                                         AMP
                     (B Conc. )       25% (20-25 min)                                                                                         30               AMP                       30      ADP
                     Column temp.:    30 °C                            5 mixed oligonucleotides                                                                                                  ATP                                         Pharmacokinetics
                     Injection volume:  4 µL                           (including desalted oligonucleotides)                                  20                                         20
                                                                                                                                                        ADP
                     Detection:       UV 260 nm (SPD-M40), UHPLC standard cell
                                                                        5 mixed oligonucleotides
                     Vial:            Shimadzu 1.1 mL sample vial       (HPLC-puri ed)                                                        10                                         10
                                                                                                                                              0                                          0
                                                                      0.0        5.0       10.0        min
                                                                                                                                               0.0  1.0  2.0  3.0  4.0  5.0  6.0  7.0  min  0.0  1.0  2.0  3.0  4.0  5.0  6.0  7.0  min
                                                                       Figure 2   Chromatograms of the oligonucleotide mixture containing impurities
                                                                                                                                         Metal-sensitive                    Poor peak shape  Material that inhibits   Sharp peaks
                                                                                                                                         compounds                                      adsorption
                        Conclusions                                                                                                               Adsorption to internal surface  Peak tailing                        Excellent separation  Other

                     By using Nexera XS inert and Shim-pack Bio IEX, it is possible to reproducibly separate the desired oligonucleotide from impurities such as protecting
                     groups generated during chemical synthesis or oligonucleotides with different chain lengths generated by incomplete synthesis.  Stainless steel tubing


        6                                                                                                                                                                                                                                    7
                                                                                                            index                                                                                                                  index
   1   2   3   4   5   6   7   8   9   10   11