Page 6 - Oligonucleotide Therapeutics Solution Guide

Characteristic analysis
Purification
Quality Control

Separation of Impurities Nexera XS inert

Features
Oligonucleotide Analysis by Ion
The potential adsorption of an analyte onto wetted surfaces of System Controller Modification
Exchange Chromatography (IEX) UHPLC instruments poses some critical challenges when analyzing SCL-40, CBM-40/40lite Target selection
biomolecules. While elevated pressure tolerance is required to
click here achieve optimal chromatographic separation when using small Used to coordinate actions of the overall
system, this controller offers intuitive operation
particle size columns, the inertness of the wetted surfaces is also that minimizes the stress involved in operating
the system, from startup to shutdown.
of the utmost importance, as is resistance to corrosion due to the
• Short chain oligonucleotides can be separated based on the base unit. use of mobile phases with high salt concentrations and extreme Detector
pH values. SPD-40/40V/M40
• Oligonucleotides can be separated from impurities such as protecting The Nexera XS inert system offers the ideal solution for the Inert type cells for UHPLC analysis eliminate
groups used in the chemical synthesis process. separation of biomolecules by combining the elevated pressure the risk of adsorption on the detector.
Low-diffusion cell, which has 5 mm of
benefits tolerance of a UHPLC system with complete inertness of the optical path length, can also be selected.
• It can be analyzed using mobile phases with high salt concentrations sample flow path, ensured by the absence of wetted metal Excision
and a wide pH range. surfaces and offering ultra-high resistance to corrosion. Solvent Delivery Unit Unprotected
LC-40D XSi Oligomer synthesis
Designed with corrosion-resistant non-stainless
steel materials, it offers rugged, low-pulsation
Methods and Results performance, advanced AI features and solvent
blending capabilities. (optional).
Sample 5‘-TCTTGGTTACATGAAA-3‘ (16 mer)
5‘-TCTTGGTTACATGAAAT-3‘ (17 mer) Autosampler
5‘-TCTTGGTTACATGAAATC-3‘ (18 mer) SIL-40C XSi
5‘-TCTTGGTTACATGAAATCC-3‘ (19 mer) Unconstrained Recovery and Sensitivity This high-performance autosampler
5‘-TCTTGGTTACATGAAATCCC-3‘ (20 mer)
Reduces sample loss due to adsorption to metal and achieves excellent sensitivity. features nonmetal materials for all surfaces
Conc., Volume 5 µmol/L, 4 µL that contact liquids. That inhibits metal-ad-
Preparation Dilution in ultrapure water to the concentrations above. Clear Resolution without Restrictions sorption of biomolecules.
Analytical As shown in Table 1 Improves peak shape and achieves excellent chromatographic separation. Purification
Conditions UHPLC Inert Switching Valve
Figure 1 Chromatogram of oligonucleotides mixture FCV-0206H2i/FCV-0607H2i
Results Target oligonucleotides in 20 mer and 4 sequences that were Assured Reliability and Reproducibility
deleted from n-1 to n-4 on the 3’ terminus of target were Designed with adsorption-inhibiting
prepared as impurities derived from the synthesis. All of them Table 2 Relative standard deviation (% RSD) of each component (n = 6) Reliable data for metal-adsorbing compounds with high reproducibility. materials for all wetted surfaces.
were unmodified single-stranded DNA and synthesized by
a solid phase synthesis (HPLC-purified). For ion-exchange Length(mer) Retention time Area
chromatography, Figure 1 shows a chromatogram of a mixture 16 0.138 0.224
of five-sequence oligonucleotide. Each oligonucleotide was 17 0.105 0.335
separated by their length. Table 2 shows the relative standard Finger Tight Fittings for Simple and Secure Connections
deviations (% RSD, n = 6) of the retention time and area of the 18 0.098 0.494
16 - 20 mer oligonucleotide mixture, with RSD% less than 1% 19 0.085 0.161 Nexera XS inert systems feature tubing connections with unique finger-tight
for both parameters. 20 0.075 0.307 fittings. They can achieve connections with up to 105 MPa of pressure capacity by
And then, a mixture of five oligonucleotides was prepared (four
of them were HPLC-purified while 1 was only desalted) and finger-tightening and without creating any dead volume.
compared with the mixture of all HPLC-purified nucleotides
(Figure 2). The target oligonucleotides were completely separated 1 : 5’- TCTTGGTTACATGAAA -3’
from impurities such as free protecting groups and shorter length 2 : 5’- TCTTGGTTACATGAAAT -3’ 3 4 Quality Control
oligonucleotides. 3 : 5’- TCTTGGTTACATGAAATC- 3’ Characteristic analysis
4 : 5’- TCTTGGTTACATGAAATCC -3’ 2 5
5 : 5’- TCTTGGTTACATGAAATCCC -3’ 1
Table 1 Analysis Conditions Resolution without Restrictions
System: Nexera XS inert
Column: Shim-pack Bio IEX Q-NP The Nexera XS inert system is equipped with unique technology that ensures the complete inertness of the sample flow path. The system provides
(100 mm × 4.6 mm I.D., 5 µm) excellent peak shape and unsurpassed chromatographic separation by effectively inhibiting the adsorption of target compounds to internal surfaces.
Mobile phase A: 10 mmol/L NaOH
Mobile phase B: 10 mmol/L NaOH containing 1 mol/L NaClO4
Shorter length of Standard UHPLC (stainless steel-based) Nexera XS inert
Flow rate: 0.8 mL/min Protecting groups oligonucleotides mAU mAU DDS
Time program: 25-32.5% (0-15 min) → 100% (15-20 min) → AMP
(B Conc. ) 25% (20-25 min) 30 AMP 30 ADP
Column temp.: 30 °C 5 mixed oligonucleotides ATP Pharmacokinetics
Injection volume: 4 µL (including desalted oligonucleotides) 20 20
ADP
Detection: UV 260 nm (SPD-M40), UHPLC standard cell
5 mixed oligonucleotides
Vial: Shimadzu 1.1 mL sample vial (HPLC-puri ed) 10 10
0 0
0.0 5.0 10.0 min
0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 min 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 min
Figure 2 Chromatograms of the oligonucleotide mixture containing impurities
Metal-sensitive Poor peak shape Material that inhibits Sharp peaks
compounds adsorption
Conclusions Adsorption to internal surface Peak tailing Excellent separation Other

By using Nexera XS inert and Shim-pack Bio IEX, it is possible to reproducibly separate the desired oligonucleotide from impurities such as protecting
groups generated during chemical synthesis or oligonucleotides with different chain lengths generated by incomplete synthesis. Stainless steel tubing

6 7
index index